0 (0) 0 0.0 0.0 (0) 0 0.0 0.0 (0) 0 0.0  China 250 26,789 0.0 (0) 0 0.0 1.2 (3) Selleck PF-2341066 7 2.6 38.0 (95) 422 157.5  Greece 250 9,552 0.0 (0) 0 0.0 0.0 (0) 0 0.0 1.6 (4) 24 25.1  Guatemala 250 20,057 0.8 (2) 11 5.5 0.8 (2) 5 2.5 0.4 (1) 2 1.0  India 259 36,337 5.4 (14) 24 6.6 6.2 (16) 48 13.2 18.9 (49) 166 45.7  Korea 250 15,032 1.6 (4) 4 2.7 2.0 (5) 9 6.0 16.4 (41) 107 71.2  Malaysia 256 29,792 0.4 (1) 2 0.7 2.7 (7) 27 9.1 5.5 (14) 85 28.5  Malaysian females 87 98,530 1.1 (1) 1 0.1 12.6 (11) 17 1.7 13.8 (12) 51 5.2  Mart & Guad 153 28,268 1.3 (2) 2 0.7 0.0 (0) 0 0.0 0.7 (1) 5 1.8  Mexico

266 25,587 0.4 (1) 1 0.4 2.3 (6) 16 6.3 3.4 (9) 18 7.0 check details  Philippines 250 19,819 0.4 (1) 1 0.5 0.0 (0) 0 0.0 4.8 (12) 29 14.6  Poland 258 11,906 0.4 (1) 1 0.8 0.0 (0) 0 0.0 0.0 (0) 0 0.0  Sri Lanka 262 17,254 1.1 (3) 5 2.9 2.7 (7) 8 4.6 13.0 (34) 67 38.8  Taiwan 250 21,155 0.0 (0) 0 0.0 0.0 (0) 0 0.0 1.2 (3) 7 3.3  Thailand 250 26,133 0.0 (0) 0 0.0 2.4 (6) 21 8.0 7.2 (18) 234 89.5 2006    Bangladesh 258 48,529 0.0 (0) 0 0.0 9.3 (24) 37 7.6 33.3 (86) 285 58.7  Cameroon 261 49,096 1.9 (5) 12 2.4 10.3 (27) 82 16.7 46.7 (122) 1,324 269.7  Colombia 251 10,7686 3.2 (8) 17 1.6 13.9 (35)

88 8.2 46.2 (116) 752 69.8  Costa Rica 250 14,297 1.6 (4) 8 5.6 6.4 (16) 30 21.0 24.0 (60) 301 210.5  India 259 41,890 1.2 (3) 5 1.2 6.6 (17) 58 13.8 31.3 (81) 321 76.6  Indonesia 290 12,4066 0.3 (1) 1 0.1 7.6 (22) 68 5.5 20.3 (59) 136 11.0  Morocco 250 15,903 3.2 (8) 12 7.5 18.8 (47) 126 79.2 63.2 (158) 726 456.5  Portugal 250 15,126 0.8 (2) 2 1.3 6.0 (15) 47 31.1 27.2 (68) 236 156.0  Senegal 249 18,199 2.8 (7) 13 7.1 15.3 (38) 111 61.0 12.4 (31) 119 65.4  Spain 250

19,167 2.8 (7) 13 6.8 14.8 (37) 104 54.3 12.4 (31) 118 61.6  Tanzania 250 20,550 1.2 (3) 5 2.4 11.6 (29) 86 41.8 62.0 (155) 760 369.8 Total 6,359 90,6252 1.2 (78) 140 1.5 5.8 (370) 995 11.0 19.8 (1,260) 6,295 69.5 There was a wide variation in the this website incidence of agrochemical-related incidents between countries. No users in six countries (Bangladesh, Brazil, China, Greece, Taiwan and Thailand) had experienced a serious incident in the last Epothilone B (EPO906, Patupilone) 12 months and only one user had experienced a serious incident in four other countries (Indonesia, Mexico, Poland and the Philippines).

Cluster P-6 consisted of 32 isolates. All grew at 40°C, were resistant

to heavy metals, and sensitive to streptomycin. They also grew at pH 4.5-9.5 and in medium supplemented with 1-4% CP673451 supplier NaCl. These isolates had a wide range of water stress tolerance. Cluster P-7 consisted of 25 isolates. All grew in medium supplemented with 6% NaCl, at water stress level of -1.5 MPa and were resistant to heavy metals and antibiotics. Cluster P-8 consisted of 43 isolates that were resistant to heavy metals and to antibiotics. They grew at 32-40°C, 3-4% NaCl, and had good tolerance to water stress. Cluster P-9 consisted of four isolates, sensitive to Zn and resistant to antibiotics. They could grow at neutral-alkaline pH, were tolerant to water stress and to 5% NaCl. Cluster P-10 consisted of four isolates. All grew at 40°C, tolerant to salinity, water stress and selleck chemicals llc were sensitive to heavy metals and streptomycin. Cluster P-11 consisted of nine isolates that grew

in medium supplemented with 3% NaCl, and had a wide range of tolerance to temperature, water stress and heavy metals. All isolates were sensitive to tetracycline. The phenotypic patterns observed in the cluster analysis clearly showed tolerance to the multiple environmental stresses which are common in marginal soils of arid and Nepicastat semi-arid regions. This kind of phenotypic diversity observed in the rhizobia populations could offer selective advantages in survival and adaptation to these harsh environments. Genotyping with rep-PCR resolved phenotypic diversity in S. meliloti and S. medicae Rep-PCR analysis of consensus sequences REP and ERIC, capable of amplifying repetitive and conservative elements diffused/dispersed in DNA, revealed high intraspecific

diversity among the 157 isolates and classified the isolates into 148 genotypes. Among the genotypes, only three genotypes were observed 2 times and one genotype was found 3 times and the remaining genotypes were detected only once. These identical genotypes were considered as clones and these clonal Dimethyl sulfoxide isolates were found only in S. meliloti. Since, each genotype characterized by unique combination of rep-PCR profiles, these genotypes can be considered as different strains. The dendrogram was constructed based on the genotype profiles and provided more information on the specific variability of the strains (Figure 4). At 84% level, there were 13 definitely separated and delimited clusters of strains. Each cluster contained strains with a range of phenotypic diversity. Each cluster was formed by strains from different areas of collection and with different phenotypic traits, except the cluster G-4 (all the 4 strains of the cluster with the same phenotype). In other words, within the same location/region of collection, the strains architecture was phenotypically and genetically divergent.

coli/Bacillus shuttle vector pHT304-pXyl, in which xylR and the xylA promoter from Bacillus Protein Tyrosine Kinase inhibitor subtilis was inserted into the pHT304 cloning site [60] allowing xylose-inducible expression of downstream cloned genes, was a kind gift from Dr Didier Lereclus

(INRA, France). The gene encoding Hbl B, hblA [61], was PCR amplified from B. cereus ATCC 14579 using primers tatggatcctaaattggaggaaaatgaaatg and tagaggtaccatgttttagttcactttacaa and inserted into pHT304-pXyl using the primer-incorporated BamHI and KpnI restriction sites (underlined). The resulting plasmid was subjected to site directed mutagenesis using the QuikChange mutagenesis protocol (Stratagene) in order to express a mutated form of Hbl B in which three of the amino acids in the hydrophobic central section

of the signal peptide sequence were changed into negatively charged amino acids (Figure 1A and 1B). The plasmids were introduced by electroporation into B. cereus NVH 0075/95 and Bt407ΔflhA [62]. The tatAC operon and the comGA gene in B. cereus ATCC 14579 were deleted by allelic exchange with a spectinomycin resistance cassette (SpR) from pDG1726 [63] as described [64]. Growth conditions and find more sample preparation B. cereus and B. thuringiensis were grown in brain heart infusion (BHI) medium at a temperature of 32°C, since toxin production generally is maximal at this temperature [65]. For analysis of Hbl B overexpressing strains, strains containing plasmid were grown for 3 hours in BHI supplemented with 10 μg ml-1 erythromycin, induced with 20 mM xylose and grown for 2 hours before harvesting. For analysis of mutant strains, overnight cultures were supplemented with 250 μg ml-1 spectinomycin, and culture supernatants and pellets were harvested 1 hour after the onset of stationary phase (t0), as the concentration of toxins appears to be maximal at this time [34]. t0 was defined as the breakpoint

in the slope of the vegetative growth phase curve as determined by measuring the optical density at 600 nm. For analysis of inhibition of SecA by sodium azide, ATCC 14579 was grown to t0, washed twice in pre-warmed BHI, and resuspended in the original volume of fresh pre-warmed BHI. The culture was divided into three cultures: one containing BHI only, one Ketotifen containing 2 mM sodium azide, and one containing 2 mM sodium azide and 200 μM synthetic PapR pentapeptide LPFEY (corresponding to the five carboxy-terminal amino acids in PapR from B. cereus ATCC 14579), incubated as before for a further 20 minutes, and harvested by centrifugation. Culture supernatants were collected by centrifugation and concentrated tenfold for examination of Hbl B overexpressing strains and the tatAC, comGA, and flhA mutants, or 40-fold for azide-treated cultures, by precipitation with 80% ammonium sulphate. Precipitated proteins were dissolved in and selleck chemicals dialysed against TES buffer (20 mM Tris pH 7.5, 0.8% NaCl, 1 mM EDTA).

003, and 0.060 ± 0.004, respectively; P < 0.01). Again, the ability to form biofilm on polystyrene plates of the twelve strains was not significantly correlated to their ability to form biofilm on IB3-1 cell monolayers (Pearson r, -0.127; P > 0.05). On the other hand, the results of the crystal violet staining showed a statistically significant positive correlation (Pearson r = 0.641; P < 0.05) between adhesiveness and ability to form biofilm INK1197 cost (Figure 5B). Figure 5 Adhesion to and biofilm formation on polystyrene by 12 S. maltophilia isolates from CF patients. A. Adhesion (grey bars)

and biofilm (black bars) levels were assessed by crystal violet colorimetric technique and expressed as optical density read at 492 nm (OD492). OBGTC26 strain adhesiveness was significantly higher than OBGTC49, OBGTC50, and OBGTC52 strains (* P < 0.05; Kruskall-Wallis test followed by Dunn's multiple comparison post-test). Biofilm formed by OBGTC20 strain was significantly higher than that produced by OBGTC9 and OBGTC49 strains (** P < 0.01; Kruskall-Wallis A-1155463 supplier test followed by Dunn’s multiple comparison post-test). Results are expressed as means + SDs. B. Relationship between adhesion to and biofilm formation levels on polystyrene. A statistically significant positive correlation was found between adhesion and biofilm levels (Pearson r = 0.641; P < 0.05). S. maltophilia internalizes within IB3-1 cells at low levels To ascertain whether our strains

of S. maltophilia are able to enter IB3-1 cells, bacterial internalization was evaluated by a classical antibiotic exclusion assay. Due to high-level of gentamicin resistance, only 5 strains were tested for invasiveness. Gentamicin Glutathione peroxidase was highly effective on inhibiting the growth of the S. maltophilia strains (inhibition of growth ≥ 99.9%, data not shown) and was proved to be not toxic for IB3-1 cells

even when they were exposed up to 1200 μg ml-1, as assessed by the XTT assay (data not shown). The results of the invasion experiments indicated that all strains tested were able to invade IB3-1 cells, albeit at a very low level. Viable intracellular bacteria represented only a minor fraction of the total bacterial input used to infect cell monolayers. Internalization rates (cfus released upon cell lysis, compared to cfus used to infect cell monolayers) were 0.54, 0.01, 4.94, 2.48, 0.03% for OBGTC9, OBGTC10, OBGTC37, this website OBGTC38, and OBGTC50, respectively. Internalization levels (expressed as number of internalized bacteria) were not significantly related to adhesion levels (expressed as number of adhered bacteria) (Pearson r: 0.044, P > 0.05). Swimming and twitching motilities are not involved in S. maltophilia adhesion to and biofilm formation on IB3-1 cells The motility of our twelve S. maltophilia clinical isolates was assessed by swimming and twitching assays, as described in Materials and Methods. S. maltophilia strains exhibited a very broad range of motility (data not shown). Ten out of 12 (83.

Nucleosides/nucleotides are transported by one channel, one secondary carrier, and two primary active transporters. Transporters for drugs, toxins and other hydrophobic substances are selleck compound primarily secondary carriers. Systems capable of exporting multiple drugs (9.6% — 34 total) are almost exclusively secondary carriers (32 proteins). No Mxa transporter specific for pigments was identified, but transporters specific for toxins and other hydrophobic substances proved also to be secondary carriers. Macromolecular exporters transporting complex carbohydrates, proteins and lipids were identified. Of the carbohydrate transporters, two are primary active transporters and nine are secondary

carriers. Almost all protein exporters are primary carriers. A total of 17 systems (4.8%) were found to transport lipids, mostly by primary carriers, although a few secondary carriers and potential learn more group translocators were also identified. The expanded diversity of protein transport systems is probably a reflection of the tracking and microbial killing mechanisms used by Mxa, which secretes hydrolytic enzymes and secondary

metabolites with antimicrobial activities [35]. Topological analyses of Mxa transporters We analyzed the predicted topologies of all retrieved Mxa transport proteins (Figure 6a). For the most part, proteins with even numbers of TMSs outnumber proteins with odd numbers of TMSs, with notable discrepancies in channel proteins (Subclasses 1.A and 1.B) this website Metalloexopeptidase and active transporters. Single TMS primary active transport proteins are mostly ABC extracytoplasmic solute receptors with one N-terminal signal TMS, while the high number of 3 TMS proteins in 1.B is due to eight members of the Mot-Exb Superfamily, involved in motility as well as outer membrane transport. Among transporters with even numbered TMSs, 6 and 12 TMS proteins are most numerous, encompassing members of the ABC Superfamily and the MFS, respectively. Figure 6 Myxococcus xanthus transport protein topologies. Transport protein topologies for all a) proteins, b) channels, c) secondary carriers, and

d) primary active transporters in Myxococcus xanthus. Identification of distant transport proteins in Mxa To identify distant transport protein homologues in Mxa, the same procedure was used as for Sco. In Mxa, over 130 sequences were retrieved with values between 0.001 and 0.1. Similarly to Sco, most proved to be false positives with only 8 proving to be true homologues of existing TC entries; all 8 have been entered into TCDB (see Table 6). Table 6 Distant Mxa transport proteins Assigned TC # UniProt acc # Size (# aas) # TMSs Family assignment 2.A.1.15.16 Q1DA07 731 13 MFS Superfamily 2.A.7.31.1 Q1DCP3 290 10 DMT Superfamily 2.A.37.6.1 Q1D5P4 432 14 CPA2 Family 2.A.66.12.1 Q1D7B4 506 14 MOP Superfamily 3.A.1.144.3 Q1D0V1 266 6 ABC Superfamily 3.A.1.145.1 Q1D520 1200 13 ABC Superfamily 9.B.139.2.

Twenty-five different genotypes were identified from the selleck products 26 isolates analyzed. Four of the five MIRU-15 clusters were sub-divided by MIRU-15+5 (Figure 1C), and only the C1 cluster defined by MIRU-15 remained intact. Infectivity characterization i) Intracellular growth in THP-1 cells Eight of the 26 Beijing isolates characterized in the Spanish sample (1-8) were selected to assure a suitable variability according to different features: nationality of the cases (6 nationalities), drug susceptibility (2 resistant and 6 susceptible), number of IS6110 copies (9-22) and phylogenetic group (groups 3 and 4) (Table 2). The strain responsible for the outbreak on Gran Canaria Island was also included

(isolate no. 1). To widen the geographic setting to the Mediterranean area and to increase both the number JNK-IN-8 clinical trial of Beijing representatives analyzed and the number of isolates involved in clusters, we included to the Spanish Beijing representatives, eight additional Beijing isolates (9-16) from Tuscany, Italy (Table 2). As controls, we included the virulent reference strain H37Rv and a non-Beijing representative orphan strain. Table 2 Beijing strains assayed in THP-1 cells Isolate code Year of isolation Strain No. Nationality Drug

susceptibilitya IS6110 copy no.b Clustered/Orphan (+/-)c RD Groupd 8687 2002 1 Spain S 16 + 3 5204 2005 2 China S 22 – 3 7992 2005 3 AC220 datasheet Ecuador S 20 – 3 8281 2004 4 filipin Armenia S 21 – 3 6955 2003 5 Moldavia S 16 – 3 6898 2005 6 Ecuador S 9 – 3 5261 2006 7 Peru INH-R 22 – 4 673

2006 8 Ecuador S 13 + 3 1819 2005 9* Brazil S NA NA 3 1884 2005 10* Peru S NA NA 3 1284 2004 11* Italy INH-R SM-R 17 + 3 1538 2004 12* Peru S 20 + 3 1409 2004 13* China S 18 + 3 1254 2003 14* China S 21 + 3 838 2002 15* China S 11 – 2 1149 2003 16* Chile S 9 + 2 a INH-R, isoniazid-resistant; SM-R, streptomycin-resistant; S, pan-susceptible. b Number of bands identified by RFLP. NA, not available. c + and – indicate clustered/orphan status of the strain. NA, not available. d Phylogenetic classification according to the presence or absence of the RD181, RD150, and RD142 genomic regions, according to Reed et al [18]. * Isolates from Tuscany. A wide range of intracellular growth rates was detected among the Beijing isolates assayed (Figure 2). Two isolates showed the highest intracellular growth rates, which differed significantly (P < 0.05) from the others. There were no significant differences in growth rate among the remaining isolates, including control strain H37Rv and the non-Beijing orphan strain. No correlation was found between the epidemiological status of the isolates (clustered/unclustered) and the intracellular growth rates. The isolate responsible for the outbreak on Gran Canaria Island was included, although it did not show increased intracellular replication. Figure 2 Intracellular growth rate in differentiated THP-1 cells.

0001 in each case). By contrast when fim2 was expressed in the Mrk- and Fim-deficient strain C3091∆fim∆mrk using this same system, no statistically significant accentuation in biofilm formation MEK inhibitor on either surface was observed (data not shown). Deletion of fim2 does not affect adhesion to human HCT-8 ileocaecal or 5637 bladder epithelial cells In vitro adhesion assays were performed to

further investigate whether KR2107 and its three isogenic mutants (KR2107∆fim, KR2107∆fim2 and KR2107∆fim∆fim2) exhibited differing cell adhesion properties. Human HCT-8 ileocecal and human 5637 bladder epithelial cell lines were chosen to investigate adherence to intestine- and bladder-derived cells, respectively. No significant differences were detectable by these in vitro tissue culture assays (Figure 5). Furthermore, despite the previously reported impaired urovirulence of a

fim-negative K. pneumoniae strain [22], the KR2107∆fim and KR2107∆fim∆fim2 mutants examined in this p38 MAPK phosphorylation study did not display any defect in adherence to bladder epithelial cells relative to KR2107 or KR2107∆fim2. It is possible that fim and/or fim2 expression was insignificant under the in vitro conditions used or that the K. pneumoniae capsule interfered with fimbrial function [38, 39]. Figure 5 Cell-adherence properties of K. pneumoniae KR2107 and its isogenic fim and/or fim2 mutants. (A) In vitro adhesion assays to human HCT-8 ileocaecal cells. (B) In vitro adhesion assays to human 5637 bladder epithelial cells. In ZD1839 chemical structure both cases percentages of bacteria that remained adherent to cell

monolayers after 3 h of incubation at 37°C followed by careful AP26113 washing are shown. Bars represent means and standard deviations. Deletion of fim2 does not affect murine intestinal colonization Epidemiological studies have elucidated that the first step in the majority of K. pneumoniae infections is gastrointestinal tract colonization [18]. To investigate whether fim2 influences this initial step, a 1:1 mixture of KR2107 and KR2107∆fim2 was fed to three mice and faecal CFU counts were monitored for 13 days. To exclude potential type 1 fimbriae-related masking, a competition experiment between KR2107∆fim and KR2107∆fim∆fim2 was also performed. As assessed by faecal CFU counts, no strain exhibited an obvious competitive advantage and all four strains were found to readily colonize the large intestine in similar numbers (~108 – 109 CFU/g) throughout the experiment (Figure 6). Apart from confirming that fim does not affect intestinal colonization [22], these results also suggested that fim2 does not play a significant role in murine intestinal colonization by K. pneumoniae. Figure 6 Murine intestinal colonization of K. pneumoniae KR2107 and its isogenic fim and/or fim2 mutants. (A) Intestinal co-colonization following oral feeding with a 1:1 mixture of KR2107 and KR2107∆fim2.

E. coli DH5α was purchased from Invitrogen selleck chemical (Carlsbad, CA, USA). S. flexneri and E. coli were grown at 37°C in Luria–Bertani (LB) medium (Oxoid, Wesel, Germany). All bacterial strains were grown on Salmonella–Shigella (SS) agar (Oxoid) before being transferred to an LB agar plate. Strains were then incubated overnight at 37°C, then stored at −20°C in LB broth containing 15% glycerol. Screening of clinical specimens by mPCR The ipaH, ial, and set1B genes were detected by mPCR with primers designed according to the sequences of these genes in SF301 (Table 1) [3, 5, 7]. Clinical S. flexneri isolates (n = 86) were tested using mPCR. The mPCR mixture (20 μL) consisted of 1.8× PCR buffer

(3 mM MgCl2, 130 μM dNTP; Invitrogen), 0.5 μM ial primer, 0.3 μM ipaH primer, 0.3 μM set1B primer, 1 U of Taq DNA polymerase (Invitrogen), and 10 μL of bacterial lysate. Thermal cycling Poziotinib price conditions involved an initial denaturation step at 95°C for 5 min, followed by 30 cycles of 94°C for 1 min, 56°C for 1 min, and 72°C for 2 min, and a final extension step at 72°C for 7 min after the 30th cycle. Table 1

Sequences of oligonucleotide primers used in this study Target gene Gene position on SF301 genome or virulent plasmid pCP301 Primer* Primer sequence (5′→3′) Length (bp) Primers for detection of virulence-associated AZD3965 order genes of S. flexneri by mPCR ipaH 1422225–1422835 ** ipaH-F CCTTGACCGCCTTTCCGATA 611     ipaH-R CAGCCACCCTCTGAGAGTACT   ial 133550–133869*** ial-F CTGGATGGTATGGTGAGG 320     ial-R CCAGGCCAACAATTATTTCC   set1B 3069523–3069669** set1B-F GTGAACCTGCTGCCGATATC 147     set1B-R ATTTGTGGATAAAAATGACG   Primers MRIP for amplifying int , orf30 , sigA and pic on PAI-1 of S. flexneri 2a int 3052736–3053998** int-F ATGGCACTGACTGACGCAAA 400     int-R TGCCGATAAAGGGGAAAACG   orf30 3096187–3097975** orf30-F CTTATCACTGAGCGTCTGGT 1,102     orf30-R GTGAAATTCCTGCCTCAATA   sigA 3060437–3064294** sigA-F AGTCATATTACAGGTGGATTAG 1,866     sigA-R TATACTCAGGGTTGCGTTTT   pic 3067737–3070949**

pic-F AGAACATATACCGGAAATTC 1,219     pic-R ACCCTGACGGTGAATAAACT   Primers for homologous recombination to construct pic knockout strain upstream of pic 3067236–3067745** uppic-F-NotI AAGCGGCCGCCATAGCAGACTGGCCGGTCAACC 520     uppic-R-XbaI CCTCTAGAATGTTCTGATGTGGGGGTAAAGGGC   downstream of pic 3071850–3072358 ** downpic-F-XbaI CCTCTAGAATTCACTATGGATTCTCCATGAT 517     downpic-R-BamHI AAGGATCCCGTCGTCCGTCTGGCACC   upstreamof pic 3066436–3072733** Upuppic-F GCTGAACTGC TGGAGCCGCT 1176 downstream of pic   Downdown Pic-R CAGCGGCGAAATACTGTACC   pic coding frame work 3067737–3070949** pic-pSC-F-PfMlI AAACCATCGAATGGATGCAGGACGATTTCGATGCCCCCGTAGAC 3,213     pic-pSC-R-AclI TTTAACGTTTCAGAACATATACCGGAAATTCGCGTT   *F, forward primer; R, reverse primer. **SF301 GenBank Accession No. AE005674. ***SF301 large virulent plasmid pCP301 GenBank Accession No. AF386526. Underlined sequences represent restriction endonuclease sites.

Science 316:1462–1465PubMedCrossRef Mancal T, Fleming GR (2004) Probing electronic coupling in excitonically coupled heterodimer complexes by two-color three-pulse photon echoes. J Chem Phys 121:10556–10565PubMedCrossRef Mukamel S (1995) Principles of nonlinear optical spectroscopy. Oxford University Press, New York Parkinson DY, Lee H, Fleming GR (2007) Measuring electronic

coupling in the reaction center of purple photosynthetic bacteria by two-color, three-pulse photon echo peak shift spectroscopy. J Phys Chem B 111:7449–7456PubMedCrossRef Parson WW (2007) Modern optical spectroscopy. Springer, find more BerlinCrossRef Read EL, Engel Selleckchem GW 572016 GS, Calhoun TR, Ahn TK, Mancal T, Cheng YC, Blankenship RE, Fleming GR (2007) Cross-peak-specific two-dimensional electronic spectroscopy. Proc Natl Acad Sci USA 104:14203–14208PubMedCrossRef Read EL, Schlau-Cohen GS, Engel GS, Wen JZ, Blankenship RE, Fleming GR (2008) Visualization of excitonic structure in the Fenna–Matthews–Olson photosynthetic complex by polarization-dependent two-dimensional electronic spectroscopy. Biophys J 95:847–856PubMedCrossRef Rulliere

PF-3084014 order C (ed) (2003) Femtosecond laser pulses: principles and experiments, 2nd edn. Springer, USA Scholes GD, Fleming GR (2000) On the mechanism of light harvesting in photosynthetic purple bacteria: B800 to B850 energy transfer. J Phys Chem B 104:1854–1868CrossRef Van Amerongen H, Valkunas L, Van Grondelle R (2000) Photosynthetic excitons. World Scientific, Singapore Yu JY, Nagasawa Sirolimus clinical trial Y, Van Grondelle R, Fleming GR (1997) Three pulse echo peak shift measurements on the B820 subunit of LH1 of Rhodospirillum rubrum. Chem Phys Lett 208:404–410CrossRef Zanni MT, Ge NH, Kim YS et al (2001) Two-dimensional IR spectroscopy can be designed to eliminate the diagonal peaks and expose only the crosspeaks needed for structure determination. Proc Natl Acad Sci USA 98:11265–11270PubMedCrossRef

Zigmantas D, Read EL, Mancal T, Brixner T, Gardiner AT, Cogdell RJ, Fleming GR (2006) Two-dimensional electronic spectroscopy of the B800-B820 light-harvesting complex. Proc Natl Acad Sci USA 103:12672–12677PubMedCrossRef”
“Introduction The process of photosynthesis relies upon the efficient absorption and conversion of the radiant energy from the Sun. Chlorophylls and carotenoids are the main players in the process. While the former are involved in light-harvesting and charge separation process, the latter also play vital photoprotective roles. Photosynthetic pigments are typically arranged in a highly organized fashion to constitute antennas and reaction centers, supramolecular devices where light harvesting and charge separation take place. The very early steps in the photosynthetic process take place after the absorption of a photon by an antenna system, which harvests light and eventually delivers it to the reaction center (Van Grondelle et al. 1994).

PubMedCentralPRIMA-1MET research buy PubMedCrossRef 22. Fernebro J, Andersson I, Sublett J, Morfeldt E, Novak R, Tuomanen E, Normark EX 527 mw S, Normark BH: Capsular expression in Streptococcus pneumoniae negatively affects spontaneous and antibiotic-induced lysis and contributes to antibiotic tolerance. J Infect Dis 2004, 189(2):328–338.PubMedCrossRef 23. Hathaway LJ, Brugger SD, Morand B, Bangert M, Rotzetter

JU, Hauser C, Graber WA, Gore S, Kadioglu A, Muhlemann K: Capsule type of Streptococcus pneumoniae determines growth phenotype. PLoS Pathog 2012, 8(3):e1002574.PubMedCentralPubMedCrossRef 24. Hammerschmidt S, Wolff S, Hocke A, Rosseau S, Muller E, Rohde M: Illustration of pneumococcal polysaccharide capsule during adherence and invasion of epithelial cells. Infect Immun 2005, 73(8):4653–4667.PubMedCentralPubMedCrossRef 25. Hathaway LJ, Stutzmann Meier P, Battig P, Aebi S, Muhlemann K: A homologue of aliB is found in the capsule region of nonencapsulated Streptococcus pneumoniae . J Bacteriol 2004, 186(12):3721–3729.PubMedCentralPubMedCrossRef 26. Salter SJ, Hinds J, Gould KA, Lambertsen L, Hanage WP, Antonio M, Turner P, Hermans PW, Bootsma HJ, O’Brien KL, Bentley SD: Variation at the capsule locus, cps , of mistyped and non-typable Streptococcus pneumoniae isolates. Microbiol 2012, 158(Pt 6):1560–1569.CrossRef

NVP-BGJ398 mw 27. Hanage WP, Kaijalainen T, Saukkoriipi A, Rickcord JL, Spratt BG: A successful, diverse disease-associated lineage of nontypeable pneumococci

Phosphatidylinositol diacylglycerol-lyase that has lost the capsular biosynthesis locus. J Clin Microbiol 2006, 44(3):743–749.PubMedCentralPubMedCrossRef 28. Arrecubieta C, Lopez R, Garcia E: Molecular characterization of cap3A , a gene from the operon required for the synthesis of the capsule of Streptococcus pneumoniae type 3: sequencing of mutations responsible for the unencapsulated phenotype and localization of the capsular cluster on the pneumococcal chromosome. J Bacteriol 1994, 176(20):6375–6383.PubMedCentralPubMed 29. Waite RD, Struthers JK, Dowson CG: Spontaneous sequence duplication within an open reading frame of the pneumococcal type 3 capsule locus causes high-frequency phase variation. Mol Microbiol 2001, 42(5):1223–1232.PubMedCrossRef 30. Waite RD, Penfold DW, Struthers JK, Dowson CG: Spontaneous sequence duplications within capsule genes cap8E and tts control phase variation in Streptococcus pneumoniae serotypes 8 and 37. Microbiol 2003, 149(Pt 2):497–504.CrossRef 31. McEllistrem MC, Ransford JV, Khan SA: Characterization of in vitro biofilm-associated pneumococcal phase variants of a clinically relevant serotype 3 clone. J Clin Microbiol 2007, 45(1):97–101.PubMedCentralPubMedCrossRef 32. Allegrucci M, Sauer K: Characterization of colony morphology variants isolated from Streptococcus pneumoniae biofilms. J Bacteriol 2007, 189(5):2030–2038.PubMedCentralPubMedCrossRef 33.