TAK1 is involved in sodium L‑lactate‑stimulated p38 signaling and promotes apoptosis
Qingen Da1,2 · Zilong Yan1 · Zhangfu Li1 · Zhen Han2 · Mingming Ren2 · Lei Huang2 · Xiaowei Zhang3 · Jikui Liu1 · Tao Wang2

Received: 26 April 2020 / Accepted: 15 October 2020
© Springer Science+Business Media, LLC, part of Springer Nature 2020

Abstract
In the present study, we found that the phosphorylation of p38 mitogen-activated protein kinase (p38) was significantly increased in L-lactate-treated HeLa cells, which is under concentration- and time-dependent manner. The protein level of Bcl-2 was significantly reduced and Bax and C-caspase3 were significantly increased in L-lactate-treated cells. qRT-PCR analysis suggested that the expression level of apoptosis-related genes Bax, C-myc, and FasL were significantly upregulated by L-lactate treatment. In addition, p38 inhibitor SB203580 blocked the L-lactate-stimulated phosphorylation of p38 (p-p38) and apoptosis, which suggested that L-lactate-stimulated apoptosis may be related to the activation of p38. Moreover, TAK1 inhibitor Takinib reduced L-lactate-triggered phosphorylation of p38 and also apoptosis; however, ASK1 inhibitor NQDI-1 did not. Cells transfected with siRNA of TAK1(siTAK1) showed similar results with Takinib inhibitor. These results suggested that the L-lactate treatment elevated activation of p38 and apoptosis was related to TAK1. In this study, we suggested that TAK1 plays an important role in L-lactate-stimulated activation of p38 affecting apoptosis in HeLa cells.
Keywords L-lactate · Apoptosis · TAK1 · p38

Abbreviations
L-Lactate Sodium L-Lactate
PCD The programmed cell death MAPK Mitogen-activated protein kinase MAP3Ks MAP2K kinases
p38 p38 mitogen-activated protein kinase
p-p38 phosphorylated p38
ERK Extracellular signal-regulated kinases
JNK/SAPK c-jun N-terminal or stress-activated protein kinases
Bcl-2 BCL-2 apoptosis regulator
Bcl-xl BCL-2 like 1
Mcl1 Mcl1 apoptosis regulator
Bcl-B BCL-2 like 10
Bax BCL-2associated X, apoptosis regulator Fas Fas cell surface death receptor
FasL Fas ligand
ASK1 Apoptosis signal-regulating kinase 1

TAK1 TGF (transforming growth factor)

 Jikui Liu
[email protected]
 Tao Wang [email protected]
1 Department of Hepatobiliary Surgery, Peking University Shenzhen Hospital, Shenzhen Peking University, The Hong Kong University of Science and Technology Medical Center, Shenzhen, China
2 Department of Cardiovascular Surgery, Peking University Shenzhen Hospital, Shenzhen Peking University, The Hong Kong University of Science and Technology Medical Center, Shenzhen 518000, China
3 School of Basic Medical Sciences, Peking University, Beijing, China
β-activated kinase 1

Introduction
Apoptosis is the process by which the cells enters a process that ultimately results in the controlled death of the cell [1, 2]. The process of apoptosis is highly conserved, and the main cascade of events is regulated by the Bcl-2 gene fam- ily. The Bcl-2 gene family is mainly located in the outer mitochondrial membrane, such as Bax and Bak, are pro- motes apoptosis, while Bcl-2, Bcl-xl, Mcl1, and Bcl-B are in charge of inhibiting apoptosis signaling [3–5].

The p38 mitogen-activated protein kinase (p38) activation has been shown to mediate several cellular processes such as apoptosis, cell cycle, proliferation, inflammation, survival, and autophagy [6–8]. It has been reported that the activa- tion of p38 phosphorylates Bcl-xL and Bcl-2 results in Fas- induced apoptosis of CD8+ T cells [9]. p38 activates p53 and results in enhanced apoptosis by regulating the phospho- rylation of p53. p38 inhibitor SB202190 blocked the p53- induced apoptosis in an epidermal cell line [10]. SB203580, a p38-specific inhibitor, prevented MKK6-induced apoptosis in hepatoma cell lines [11]. Protoapigenone had a significant inhibition of prostate tumor growth, which was associated with the induction of apoptosis by activation of p38 and JNK1/2 in prostate cancer cell [12].
Several MAP3Ks (MAP2K kinases) have been shown to activate p38. Two of them, ASK1 and TAK1, are the key MAP3Ks for activating p38. They have been linked to par- ticular stimuli. ASK1 plays a key role in the activation of p38 by oxidative stress, while TAK1 most likely mediates the activation of p38 induced by cytokine receptors [7].
More evidence suggested that lactate plays an important role in regulating different signaling pathways [13–15]. Recent study suggested that the lactate significantly acti- vated the apoptotic pathway in Nucleus Pulposus cells [16]. Present study found that L-lactate stimulates the phospho- rylation of p38 and promotes apoptosis. Furthermore, in this study, we investigated whether L-lactate-stimulated activa- tion of p38 and apoptosis were related to its upstream kinase MAP3Ks.

Materials and methods
Materials

Dulbecco’s modified Eagle’s medium (DMEM, HyClone, SH30022.01), fetal bovine serum (FBS), and penicillin- streptomycin solution (PS HyClone, SV30010). SB203580, Asiatic acid, NQDI-1 and Takinib (TargetMol). Sodium L-lactate (L-lactate, sigma, PHR1113), siCtrl and siTAK1 (Gene Pharma), Lipofectamine RNAiMAX Reagent (Inv- itrogen, 13778-150), proteinase inhibitor cocktail (Roche, 4693159001), and phosphatase inhibitor cocktail (Roche, 4906847001). BCA Protein Assay Kit (ThermoFisher Scientific), p38 (Cell Signaling Technology, 8690), Phos- pho-p38(T180/Y182)(Cell Signaling Technology, 9215), ERK1/2(Cell Signaling Technology, 9102), Phospho- ERK1/2 (Thr202/Tyr204) (Cell Signaling Technology, 4370), JNK1+JNK2+JNK3 (Abcam, ab179461), Anti-
JNK1+JNK2 (phospho T183 + Y185) (Abcam, ab4821), TAK1(Abcam, ab109526), Phospho-TAK1(Thr184/187) (Cell Signaling Technology, 4508), Bax (Santa, sc-7480), Bcl-2 (Santa, sc-7382), C-caspase3 (Cell Signaling
Technology, 9661), and β-actin (Cell Signaling Technology, 8457). Trizol reagent (Invitrogen) and iScriptTM cDNA syn- thesis kit (Bio-Rad).
Cell culture

HeLa cells were obtained from the Cell resource center, Shanghai institute of life sciences, Chinese academy of sciences. HeLa cells were cultured in DMEM (HyClone, SH30022.01) containing 10% FBS and 1% PS (HyClone, SV30010) at 37 °C under a standard incubator (95% air and 5% CO2).
Drug treatment

HeLa, HEK293, and HCT116 cells were starved 16 h with no FBS DMEM, starved HeLa cells were treated by 25 μM SB203580, 20 μM Asiatic acid, 15 μM NQDI-1, and 15 μM Takinib for 21h, and then treated with and without L-lactate for 3h. In control vehicle treatment, DMSO or PBS (equal volume to the added drug) in all experiments was done.
siRNA transfection

HeLa cells were transfected at 60–70% confluence with 50 nmol/L siRNAs targeting human TAK1(siTAK1, Gene Pharma) or with a non-targeting negative control (siCtrl, Gene Pharma) using Lipofectamine RNAiMAX Reagent (Invitrogen, 13778-150) according to the manufacturer’s protocol. 6 h after transfection, the medium was changed to fresh complete cell culture medium, and cells were cultured for 48 h.
Western blot analysis

The cells were collected and homogenized with ice-cold lysis buffer (40 mM Tris-HCl pH = 7.4, 125 mM NaCl, 1% Triton X-100, 5% glycerol) with proteinase inhibitor cock- tail (Roche) and phosphatase inhibitor cocktail (Roche). The amount of total protein was quantified using the BCA Protein Assay Kit (ThermoFisher Scientific) according to the manufacturer’s guidelines. Equal amount of protein per lane (20 μg) was subjected to 8–12% SDS-PAGE. Proteins were immunoblotted with specific antibodies. Immunoreac- tive proteins were detected by the chemiluminescence assay (Millipore) using the ChemiDoc MP system (Bio-Rad). Quantification was done with Image J software.
Analysis of apoptosis

HeLa cells were processed for analysis of apoptosis using flow cytometry. Apoptosis was measured using BD PharmingenTM PE Annexin V Apoptosis Detection Kit I (BD Biosciences,

559763). Cells 1 × 105 were planted in a 16‐well plate, and after a period of incubation (24 h), cells were collected, cen- trifuged, and washed with PBS. Then the pellet is resuspended in 1xBingding Buffer at a concentration of 1 × 106 cells/ml. 100 µl of the solution (1 × 105 cells) was transferred to a new tube. Add 5 µl of PE Annexin V and 5 µl 7AAD, gently vortex the cells, and incubate at room temperature for 15 min in the dark. Add 400 µl of 1 × Binding Buffer to each tube. Samples were quantified by FACS Calibur flow cytometer (BD) and data were analyzed using FlowJo software.
RNA extraction and Quantitative Real‑Time PCR analysis

Total RNA was extracted from HeLa cells with the Trizol rea- gent (Invitrogen) following the manufacturer′s instructions. A 3 μg sample of RNA was used as a template for reverse tran- scription using the iScriptTM cDNA synthesis kit (Bio-Rad). Real-time PCR was performed via a Bio-Rad CFX96 instru- ment (Bio-Rad). The primers used for PCR are P38-F: CCC GAGCGTTACCAGAACC, P38-R: TCGCATGAATG ATG GACTGAAAT; Bcl-2-F: GGTGGGGTCATGTGTGTGG, Bcl-2-R: CGGTTCA GGTACTCAGTCATCC; Bax-F: CCC GAGAGGTCTTTTTCCGAG, Bax-R: CCAGC CCATGA TGGTTCTGAT; Cyclin D1-F: GCTGCGAAGTGGAAA CCATC, Cyclin D1-R: CCTCCTTCTGCACACATTTGAA; C-myc-F: GGCTCCTGGCAAAAGG TCA, C-myc-R: CTG CGTAGTTGTGCTGATGT; P53-F: CAGCACATGACGG AGGTTGT, P53-R: TCATCCAAATACTCCACACGC; FAS- F: TCTGGTTCTTA CGTCTGTTGC, FAS-R: CTGTGCAGT CCCTAGCTTTCC; Caspase3-F: CATGGAA GCGAATCAA TGGACT, Caspase3-R: CTGTACCAGACCGAGATGTCA; and FasL-F: GATGGCAAATGTAGACCCTACC, FasL-R:
AAGGCCCGGAGTATCACGA. The following PCR protocol
was used: 10 min at 95 °C, followed by 40 cycles of denaturing at 95 °C for 15 s, annealing at 60 °C for 30 s, and extension at 72 °C for 60s. 18s rRNA was used as an internal standard. All real-time PCRs for each sample were performed in triplicate.
Statistical analysis

Data are expressed as the mean ± SD in studies. Statistical sig- nificance was determined at p < 0.05 using unpaired Student’s t test and one-way ANOVA followed by Bonferroni’s test or Mann–Whitney U test as appropriate. Statistical significance was defined as follows: * p < 0.05, ** p < 0.01.
Results
L‑lactate stimulated phosphorylation of p38 and induced apoptosis‑related gene expression in HeLa cells

The p38 plays a critical role in regulating the activity of pro‐ and anti‐apoptotic proteins in various cells. Our results showed that the p-p38 was significantly increased (1.75 folds) in L-lactate-induced HeLa cells compared with control cells, and the protein levels of p38 were not changed (Fig. 1a). The L-lactate treatment elevated the phosphorylation of p38 in concentration and time-depend- ent manner (Fig. 1b and c). However, the phosphorylation of ERK1/2 and JNK MAPK was not significantly changed (Fig. 1a). Moreover, the protein level of Bcl-2 was sig- nificantly reduced and the Bax and C-caspase3 were sig- nificantly increased in HeLa cells treated by L-lactate (Fig. 1d). Our qRT-PCR results suggested that the mRNA levels of apoptosis-related genes, Bax, C-myc, and FasL, were significantly upregulated by the L-lactate treatment compared with control cells (Fig. 1e). Furthermore, our flow cytometry results suggested that apoptosis was sig- nificantly induced by L-lactate treatment (Fig. 1f and g).

TAK1 inhibitor Takinib reduced L‑lactate‑triggered phosphorylation of p38

ASK1 and TAK1 are the two key MAP3Ks for activating p38. Our former study suggested that L-lactate might acti- vate p38. To further explore whether L-lactate-stimulated activation of p38 is related to the upstream MAP3Ks, we order ASK1 and TAK1 inhibitors, NQDI-1 and Takinib, respectively, to clarify the role of ASK1 and TAK1 in L-lactate-induced activation of p38. Also, the p38 inhibi- tor SB203580 and activator Asiatic acid were utilized as a negative or positive control. Our results show that both SB203580- and Takinib (TAK1 inhibitor)-treated HeLa cells were blocked by the elevated p-p38 which induced by L-lactate (Fig. 2a and b); however, the NQDI-1 (ASK1 inhibitor) was not reduced the elevated p-p38 which induced by L-lactate (Fig. 2a and b), and all of these treat- ments did not change the protein levels of p38 (Fig. 2a). In addition, L-lactate significantly induced the phosphoryla- tion of TAK1 observed in vehicle, SB203580, and NQDI-1 treatment and did not significantly change the protein level of TAK1 treatment (Fig. 2a and c). The L-lactate-induced phosphorylation of TAK1 was abolished in HeLa cells treated with Takinib (Fig. 2a and c). Together, these results suggested that L-lactate-triggered phosphorylation of p38 was not related to the activity of ASK1, but TAK1.

A B

Fig. 1 L-lactate stimulated phosphorylation of p38 and induced apop- tosis-related gene expression. a Western blot analyses of the MAPK signaling pathway protein expression after treatment of HeLa cells with L-lactate was performed. Cells were treated with L-lactate (0, 10, 20 mM) for 3 h and lysed. Protein extracts were immunoblotted with specific antibodies. b Western blot analyses of the p38, p-p38 expression after treatment of HeLa cells with different concentration of L-lactate. c Western blot analyses of the p38 and p-p38 expression after treatment of HeLa cells with L-lactate in different time. d West-
ern blot analyses of the protein levels of p38, p-p38, Bcl-2, Bax, and C-caspase-3 after treatment of HeLa cells with L-lactate (0, 20, 40 mM). e The mRNA levels of apoptosis genes (p38, Bax, Bcl-2, Cas- pase3, C-myc, FAS, FasL, p53 and CyclinD1) in L-lactate-treated HeLa cells were determined by qRT-PCR. f and g. HeLa cells were treated with vehicle and 20 mM L-lactate for 24 h, and apoptosis was assessed by flow cytometry(F), Quantitative data (g). Quantitative data are shown as the mean ± SD of three independent experiments.
*p < 0.05, ** p < 0.01 versus vehicle cells.

TAK1 inhibitor Takinib reduced L‑lactate‑stimulated apoptosis

To further explore whether L-lactate-triggered
phosphorylation of p38 affecting apoptosis are related to the activity of TAK1, HeLa cells were treated by vehicle, SB203580, Asiatic acid, NQDI-1, and Takinib with and without 20 mM L-lactate, and the apoptosis was assessed

Fig. 2 TAK1 inhibitor Takinib A
reduced L-lactate-triggered
phosphorylation of p38. a HeLa cells were treated by vehicle, 25 μM SB203580, 20 μM Asiatic acid, 15 μM NQDI-1, and 15 μM Takinib with and without 20 mM L-lactate and lysed.
Western blot analyses of the protein and phosphorylated pro- tein expression were performed. b and c The protein bands were digitized by ImageJ and plotted to present the protein level of
p-p38 (b) and p-TAK1 (c). The protein bands were calculated as a ratio to total protein (TAK1 and p38) as an internal control.
Quantitative data are shown as the mean ± SD of three
independent experiments. * p < B
0.05, ** p < 0.01 versus vehicle
cells.

C

by flow cytometry. Our results show that SB203580-treated cells blocked the L-lactate-elevated apoptosis compared with vehicle group (Fig. 3a and b). p38 activator Asiatic acid could dramatically activate p38 in cells treated or untreated by L-lactate (Fig. 2a and b). Compared with no L-lactate- treated vehicle cells, Asiatic acid group shows a mark- edly enhanced apoptosis no matter cells were treated with L-lactate or not (Fig. 3a and b); these results suggested that L-lactate-induced apoptosis may be related to the activation of p38. Moreover, Takinib (TAK1 inhibitor) -treated HeLa cells were also blocked by the L-lactate-elevated apoptosis compared with no L-lactate-treated group; however, NQDI-1
did not (Fig. 3 A and B), which indicated that L-lactate- induced apoptosis may be regulated by TAK1.
Knockdown ofTAK1 reduced L‑lactate‑triggered phosphorylation of p38 and affected apoptosis

To further determine whether L-lactate induced the phosphorylation of p38 is regulated by TAK1, we trans- fected HeLa cells with Ctrl siRNA (siCtrl) and TAK1 siRNA(siTAK1). Western blot results show that TAK1 deficiency blocked the L-lactate-induced p-p38 compared with the control group cells (Fig. 4a). In addition, flow

A

B

Fig. 3 TAK1 inhibitor Takinib reduced L-lactate-triggered apoptosis. a HeLa cells were treated by vehicle, SB203580, Asiatic acid, NQDI- 1, and Takinib with and without 20 mM L-lactate for 24 h, and apop-
tosis was assessed by flow cytometry. b. Quantitative data are shown as the mean ± SD of three independent experiments. ** p < 0.01 ver- sus vehicle cells. Lac, L-lactate

A B

C

Fig. 4 Knockdown of TAK1 reduced L-lactate-triggered phosphoryl- ation of p38 and affected apoptosis. HeLa cells were transfected with Ctrl siRNA (siCtrl) and TAK1 siRNA (siTAK1) for 24 h, starved for 16 h, and treated with or without 20 mM L-lactate. a Protein extracts were immunoblotted with specific antibodies to p38, p-p38, TAK1,

and β-actin. B. apoptosis was assessed by flow cytometry in TAK1 silencing HeLa cells treated with or without L-lactate. C. Quantitative data are shown as the mean ± SD of three independent experiments.
*p < 0.05 versus vehicle cells. Lac, L-lactate.

cytometry results evaluated that the L-lactate-enhanced apoptosis was abolished by TAK1 deficiency (Fig. 4b and c). These results suggested that the L-lactate treatment elevated activation of p38 affecting apoptosis that were related to TAK1.

L‑lactate did not induce phosphorylation of p38 and apoptosis in HEK293 and HCT116 cells

To further determine whether L-lactate-induced phospho- rylation of p38 and apoptosis is general validity, HEK293 and HCT116 cells were treated by vehicle, SB203580, and Takinib with and without 40 mM L-lactate. West- ern blot results show that L-lactate did not significantly change the protein abundance of p38, p-p38, Bcl-2, Bax, and β-actin in vehicle cells (Fig. 5). This result suggested that the L-lactate may cannot induce activation of p38 and result in apoptosis in HEK293 and HCT116 cells.
Discussion
More recently, lactate has been rediscovered as signaling molecule that plays important roles in the regulation of several biological regulatory process. It has been reported that the lactate significantly activated the apoptotic path- way in Nucleus Pulposus cells [16]. Tumor-derived lac- tate reduced the expression of FAK family-interacting protein FIP200 resulting in stimulation of naïve T cells to undergo apoptosis [17]. Moreover, the lactate induces FGF21 expression by activating p38 [18]. In our study, we observed similar results which showed that L-lactate induces activation of p38 and promotes apoptosis (Fig. 1). Furthermore, we found that p38 inhibitor SB203580 blocked the L-lactate-stimulated apoptosis by reducing the phosphorylation of p38, which suggested that L-lac- tate-stimulated apoptosis may be related to the activation of p38 in HeLa cells. We also analyze the p38 signal in

A

Fig. 5 Sodium L-lactate cannot induce apoptosis in HEK293 and HCT116 cells. a HEK293 cells were treated by vehicle, 25 μM SB203580, and 15 μM Takinib with and without 40 mM L-lac- tate. Western blot analyses of the p38, p-p38, Bcl-2, Bax, and
B

β-actin expression. b HCT116 cells were treated by vehicle, 25 μM SB203580, and 15 μM Takinib with and without 40 mM L-lactate. Western blot analyses of the p38, p-p38, Bcl-2, Bax, and β-actin expression.

L-lactate-treated HEK293 and HCT116 cells; however, we found that L-lactate cannot induce activation of p38 and apoptosis in HEK293 and HCT116 cells (Fig. 5), which suggested that L-lactate-induced phosphorylation of p38 and apoptosis is not general validity and may be specifi- cally related to cell type.
Our qRT-PCR results suggested that the pro-apoptosis genes mRNA levels of Bax, C-myc, and FasL were signifi- cantly upregulated by the L-lactate treatment compared to control cells (Fig. 1e). The p38 MAP kinase activity plays a critical role in NO-mediated cell death in neurons by stimulating Bax translocation to the mitochondria, thereby activating the cell death pathway [19]. The MKK6/p38 path- way might regulate common apoptotic machinery for both s-Myc and c-Myc upstream of caspase [20]. In Rat-1 cells, a strong correlation between activation of p38 and induc- tion of c-Myc–dependent apoptosis has been investigated [21]. Binding of Fas ligand to Fas activates p38 in CD8+ T cells and that activation of this pathway is required for Fas-mediated CD8+ T-cell death [9]. Our results indicated that L-lactate-induced apoptosis may also be related to the crosstalk between p38, c-Myc, and FasL.
Classical activation of p38 signaling is mediated by the evolutionarily conserved MAPK signaling cascade reac- tion [6]. In this cascade, MAPK kinase kinases (MAP3Ks) phosphorylate and activate MAPK kinases (MAP2Ks). The MAP2Ks in the p38 signaling pathway include MKK3 and MKK6, which are highly homologous and as specific acti- vators for p38 [22]. Moreover, in some cells, MKK4 has been reported to contribute to p38a activation under certain circumstances such as UV irradiation [23].
ASK1 and TAK1 as the canonical MAP3Ks of p38 play an important role in activation of cascade reaction of p38 pathway. ASK1, a serine/threonine protein kinase, activates both JNK and p38 pathways [24]. In mammalian cells, ASK1 plays a key role in the activation of p38α by oxida- tive stress [25]. TAK1 most likely mediates the activation of p38 induced by cytokine receptors. Recently, TGF-β has been shown to be required for specifically activating TAK1 through interaction of TbetaRI with TRAF6 and then acti- vating p38 [26, 27]. Our results shown that Takinib (TAK1 inhibitor) treatment was blocked the L-lactae-induced p-p38 and apoptosis which induced by L-lactate (Figs. 2 and 3). However, the NQDI-1 (ASK1 inhibitor) was not reduced the L-lactate-elevated p-p38 and apoptosis which induced by L-lactate (Figs. 2 and 3). Moreover, TAK1 deficiency blocked the L-lactate-induced p-p38 compared with the control group cells (Fig. 4), To sum up, we suggested that L-lactate-stimulated p38 signaling affecting apoptosis may be related to TAK1 in HeLa cells.
Recent study suggested that disruption of the lactic acid
transporters MCT1/4 suppressed tumor growth as a result of intracellular acidosis, because tumor cells efficiently maintain a relatively alkaline intracellular pH to keep meta- bolic enzyme activity such as mTORC1 [28]. We analyzed the extracellular pH of cell supernatant medium treated by 40 mM L-lactate for 24 h; extracellular pH was not sig- nificantly changed, and it is still relatively alkaline (data not show). However, we didn’t test the intracellular pH. It is also reported that intracellular acidosis could induce the activation of p38 [29, 30]. Therefore, we cannot exclude that L-lactate-stimulated p38 signaling may result from

L-lactate-mediated intracellular acidification. This hypoth- esis needed further deep research.
To sum up, our study suggested that in HeLa cells L-lac- tate-stimulated apoptosis may relate to the activation of p38, and the activation of p38 signaling is involved in TAK1.
Acknowledgements This work was supported by the basic and applied basic research project of Guangdong (Youth fund projects, 2019A1515110111); the science and technology development project of Guangdong (2017B090904010); the Shenzhen municipal commis- sion of health and family planning (No. SZFZ2018071); and Chen xiaoping academician workstation of hepatobiliary surgery, Peking University shenzhen hospital, guangdong province.
Author contributions QD, ZH, MR, XZ, JL, and TW designed research; QD, ZY, ZL, and LH performed experiments; QD, ZH, LH, JL, and TW analyzed data; QD, ZH, MR, XZ, JL, and TW wrote and revised the manuscript; QD, ZY, ZL, and LH provided the reagents or materials and participated in experimental design.
Compliance with ethical standards
Conflicts of interest The authors declare that they have no conflict of interest.

Reference
⦁ Letai A (2017) Apoptosis and cancer. Ann Rev Cancer Biol 1(1):275–294. ⦁ https://doi.org/10.1146/annurev-cancerbio-05021 ⦁ 6-121933
⦁ Nagata S (2018) Apoptosis and clearance of apoptotic cells. Ann Rev Immunol 36(36):489–517. ⦁ https://doi.org/10.1146/annurev- ⦁ immun⦁ ol-042617-053010
⦁ Schlesinger PH, Gross A, Yin XM, Yamamoto K, Saito M, Waks- man G, Korsmeyer SJ (1997) Comparison of the ion channel characteristics of proapoptotic BAX and antiapoptotic BCL-2. Proc Natl Acad Sci USA 94:11357–62. ⦁ https://doi.org/10.1073/ ⦁ pnas.94.21.11357
⦁ Gross A, Jockel J, Wei MC, Korsmeyer SJ (1998) Enforced dimer- ization of BAX results in its translocation, mitochondrial dysfunc- tion and apoptosis. EMBO J 17:3878–85. ⦁ https://doi.org/10.1093/ ⦁ emboj⦁ /17.14.3878
⦁ Czabotar PE, Lessene G, Strasser A, Adams JM (2014) Control of apoptosis by the BCL-2 protein family: implications for physi- ology and therapy. Nat Rev Mol Cell Biol 15:49–63. ⦁ https://doi. ⦁ o⦁ rg/10.1038/nrm3722
⦁ Zou X, Blank M (2017) Targeting p38 MAP kinase signaling in cancer through post-translational modifications. Cancer Lett 384:19–26. https://doi.org/10.1016/j.canlet.2016.10.008
⦁ Cuadrado A, Nebreda AR (2010) Mechanisms and functions of p38 MAPK signalling. Biochem J 429:403–17. ⦁ https://doi. ⦁ o⦁ rg/10.1042/BJ20100323
⦁ Zarubin T, Han J (2005) Activation and signaling of the p38 MAP kinase pathway. Cell Res 15:11–8. ⦁ https://doi.org/10.1038/ ⦁ sj.c⦁ r.7290257
⦁ Farley N, Pedraza-Alva G, Serrano-Gomez D, Nagaleekar V, Aronshtam A, Krahl T, Thornton T, Rincon M (2006) p38 mito- gen-activated protein kinase mediates the Fas-induced mitochon- drial death pathway in CD8+ T cells. Mol Cell Biol 26:2118–29. https://doi.org/10.1128/MCB.26.6.2118-2129.2006
⦁ She QB, Chen N, Dong Z (2000) ERKs and p38 kinase phos- phorylate p53 protein at serine 15 in response to UV radiation. J Biol Chem 275:20444–9. ⦁ https://doi.org/10.1074/jbc.M0010 ⦁ 20200
⦁ Iyoda K, Sasaki Y, Horimoto M, Toyama T, Yakushijin T, Sakak- ibara M, Takehara T, Fujimoto J, Hori M, Wands JR, Hayashi N (2003) Involvement of the p38 mitogen-activated protein kinase cascade in hepatocellular carcinoma. Cancer 97:3017–26. ⦁ https:// ⦁ doi.o⦁ rg/10.1002/cncr.11425
⦁ Chang HL, Wu YC, Su JH, Yeh YT, Yuan SS (2008) Protoapi- genone, a novel flavonoid, induces apoptosis in human prostate cancer cells through activation of p38 mitogen-activated protein kinase and c-Jun NH2-terminal kinase 1/2. J Pharmacol Exp Ther 325:841–9. https://doi.org/10.1124/jpet.107.135442
⦁ Cerda-Kohler H, Henriquez-Olguin C, Casas M, Jensen TE, Lla- nos P, Jaimovich E (2018) Lactate administration activates the ERK1/2, mTORC1, and AMPK pathways differentially according to skeletal muscle type in mouse. Physiol Rep 6:e13800. ⦁ https:// ⦁ doi.org/10.14814/phy2.13800
⦁ Ippolito L, Morandi A, Giannoni E, Chiarugi P (2019) Lactate: a metabolic driver in the tumour landscape. Trends Biochem Sci 44:153–166. https://doi.org/10.1016/j.tibs.2018.10.011
⦁ Heiden MGV, Cantley LC, Thompson CB (2009) Understand- ing the warburg effect: the metabolic requirements of cell pro- liferation. Science 324:1029–1033. ⦁ https://doi.org/10.1126/scien ⦁ ce.1160809
⦁ Wu W, Zhang X, Hu X, Wang X, Sun L, Zheng X, Jiang L, Ni X, Xu C, Tian N, Zhu S, Xu H (2014) Lactate down-regulates matrix systhesis and promotes apoptosis and autophagy in rat nucleus pulposus cells. J Orthop Res 32:253–61. ⦁ https://doi.org/10.1002/ ⦁ jo⦁ r.22503
⦁ Xia H, Wang W, Crespo J, Kryczek I, Li W, Wei S, Bian Z, Maj T, He M, Liu RJ, He Y, Rattan R, Munkarah A, Guan JL, Zou W (2017) Suppression of FIP200 and autophagy by tumor-derived lactate promotes naive T cell apoptosis and affects tumor immu- nity. Sci Immunol. https://doi.org/10.1126/sciimmunol.aan4631
⦁ Jeanson Y, Ribas F, Galinier A, Arnaud E, Ducos M, Andre M, Chenouard V, Villarroya F, Casteilla L, Carriere A (2016) Lactate induces FGF21 expression in adipocytes through a p38-MAPK pathway. Biochem J 473:685–92. ⦁ https://doi.org/10.1042/BJ201 ⦁ 50808
⦁ Ghatan S, Larner S, Kinoshita Y, Hetman M, Patel L, Xia Z, Youle RJ, Morrison RS (2000) p38 MAP kinase mediates bax translocation in nitric oxide-induced apoptosis in neurons. J Cell Biol 150:335–47. https://doi.org/10.1083/jcb.150.2.335
⦁ Noguchi K, Yamana H, Kitanaka C, Mochizuki T, Kokubu A, Kuchino Y (2000) Differential role of the JNK and p38 MAPK pathway in c-Myc- and s-Myc-mediated apoptosis. Biochem Biophys Res Commun 267:221–7. ⦁ https://doi.org/10.1006/ ⦁ bbrc.1999.1952
⦁ Deschesnes RG, Huot J, Valerie K, Landry J (2001) Involvement of p38 in apoptosis-associated membrane blebbing and nuclear condensation. Mol Biol Cell 12:1569–82. ⦁ https://doi.org/10.1091/ ⦁ mbc.12.6.1569
⦁ Raingeaud J, Whitmarsh AJ, Barrett T, Derijard B, Davis RJ (1996) MKK3- and MKK6-regulated gene expression is medi- ated by the p38 mitogen-activated protein kinase signal transduc- tion pathway. Mol Cell Biol 16:1247–55. ⦁ https://doi.org/10.1128/ ⦁ mcb.16.3.1247
⦁ Brancho D, Tanaka N, Jaeschke A, Ventura JJ, Kelkar N, Tan- aka Y, Kyuuma M, Takeshita T, Flavell RA, Davis RJ (2003) Mechanism of p38 MAP kinase activation in vivo. Genes Dev 17:1969–78. https://doi.org/10.1101/gad.1107303
⦁ Matsukawa J, Matsuzawa A, Takeda K, Ichijo H (2004) The ASK1-MAP kinase cascades in mammalian stress response. J Biochem 136:261–5. https://doi.org/10.1093/jb/mvh134

⦁ Dolado I, Swat A, Ajenjo N, De Vita G, Cuadrado A, Nebreda AR (2007) p38alpha MAP kinase as a sensor of reactive oxygen species in tumorigenesis. Cancer Cell 11:191–205. ⦁ https://doi. ⦁ o⦁ rg/10.1016/j.ccr.2006.12.013
⦁ Sorrentino A, Thakur N, Grimsby S, Marcusson A, von Bulow V, Schuster N, Zhang S, Heldin CH, Landstrom M (2008) The type I TGF-beta receptor engages TRAF6 to activate TAK1 in a receptor kinase-independent manner. Nat Cell Biol 10:1199–207. ⦁ https:// ⦁ doi.o⦁ rg/10.1038/ncb1780
⦁ Yamashita M, Fatyol K, Jin C, Wang X, Liu Z, Zhang YE (2008) TRAF6 mediates Smad-independent activation of JNK and p38 by TGF-beta. Mol Cell 31:918–24. ⦁ https://doi.org/10.1016/j.molce ⦁ l.2008.09.002
⦁ Parks SK, Mueller-Klieser W, Pouyssegur J (2020) Lactate and acidity in the cancer microenvironment. Ann Rev Cancer Biol
4(4):141–158. https://doi.org/10.1146/annurev-cancerbio-03041
9-033556
⦁ Zheng M, Hou R, Xiao RP (2004) Acidosis-induced p38 MAPK activation and its implication in regulation of cardiac contractility. Acta Pharmacol Sin 25:1299–305
⦁ Zheng M, Reynolds C, Jo SH, Wersto R, Han Q, Xiao RP (2005) Intracellular acidosis-activated p38 MAPK signaling and its essential role in cardiomyocyte hypoxic injury. FASEB J 19:109– 11. https://doi.org/10.1096/fj.04-2607fje
Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.EDHS-206