ACAG 3 and the Gr E RAAS System of the PCR product was 243 bp. Bandenintensit t was determined using the amount of a program and as a controlled actinwas The house. 2.7. Western blotting Cells were treated with ice-cold RIPA buffer and then mixed with 10 mg / ml phenylmethylsulfonyl fluoride and 17 mg / ml leupeptin. After vortexing for 30 min on ice, the samples were centrifuged and the whichever type Walls were then collected, denatured, and subjected to SDS-PAGE and Western blot using specimens of antique Specific for phosphorylated forms of ERK, JNK and p38 MAPK. To measure the effect of Rh1 on the stability of t c of June, were HepG2 cells with 50 M cycloheximide for ZEITR dreams, treated as indicated in the presence or absence of 100 M Rh1. The protein content of samples was determined using Bio Rad protein assay reagent with BSA as standard. Equal protein loading was measured using an antibody Rpers against actin. 2.8. Construction of the Vector MMP-1 promoter-luciferase MMP promoter region was in the pGL basic luciferase vector by amplification of a PCR fragment strengths are nt 846-9 cloned using primers: 5 3 and 5 CAGCATGAAGCAACCAAGAA TATAGAGTCCTTGCCCTTCC third The 2818 bp PCR product was cloned into a cloning vector of PTA and the sequence was best Firmed that identical to the MMP 1 promoter. The fragment used in this study was isolated from the PTA / MMP construction by a HindIII digestion and cloned into the vector pGL basic luciferase. The 1construct pGL2/MMP was transfected into HepG2 cells. After 24 h, the cells were incubated with various concentrations of Rh1 followed for 1 h, by incubation for another 16 h in the presence or absence of PMA, followed. To determine the effects of MAPK inhibitors on the MMP 1 promoter, the transfected cells with the MAPK inhibitors SB203560, PD98059 and SP600125 at 50 M in the presence or absence of 100 M incubated for 24 h Rh1, followed by treatment with PMA for another 16 h 2.9. Transfection and Luciferase Assay HepG2 cells were plated in 12-well plates in 3  105 cells / well and overnight at the 37th The cells were then incubated with 100 200 ng PAP 1 Luc or pNF B Luc using Lipofectamine transfected for 4 h. The cells were then incubated with Rh1 at various concentrations for 24 h, and with PMA for a further 16 hours. The cells were incubated with 50 ng of vector Renillar luciferase expression co-transfected to the normalization of transfection efficiency adjusted to erm. After incubation, the cells were lysed with 250 l of reporter lysis buffer. The luciferase activity t was of 20 l of the lysate using a luminometer. 2.10. Electrophoretic mobility Ts-shift assay HepG2 cells were treated with 0.1 g / ml PMA in the presence or absence of Rh1 in serum-free DMEM. For the manufacture of nuclear fractions, the cells were washed with PBS, harvested and min in 200 l hypotonic buffer and 0.5% Igepal with 1 mM PMSF and a cocktail of protease inhibitors for 10 on ice. The cells were centrifuged at 3800 g for 10 at 4 . The supernatant of the cytoplasmic fraction was decanted, and in a hypotonic buffer. The pellets were suspended in 200 l of nuclear extract buffer and incubated on ice for 10 min, by centrifugation at 16,000 g for 10 to at  fourth Nuclear proteins Were incubated with 32P-labeled PA-1 probe on ice for 30 min, incubated for a.