coli/Bacillus shuttle vector pHT304-pXyl, in which xylR and the xylA promoter from Bacillus Protein Tyrosine Kinase inhibitor subtilis was inserted into the pHT304 cloning site [60] allowing xylose-inducible expression of downstream cloned genes, was a kind gift from Dr Didier Lereclus

(INRA, France). The gene encoding Hbl B, hblA [61], was PCR amplified from B. cereus ATCC 14579 using primers tatggatcctaaattggaggaaaatgaaatg and tagaggtaccatgttttagttcactttacaa and inserted into pHT304-pXyl using the primer-incorporated BamHI and KpnI restriction sites (underlined). The resulting plasmid was subjected to site directed mutagenesis using the QuikChange mutagenesis protocol (Stratagene) in order to express a mutated form of Hbl B in which three of the amino acids in the hydrophobic central section

of the signal peptide sequence were changed into negatively charged amino acids (Figure 1A and 1B). The plasmids were introduced by electroporation into B. cereus NVH 0075/95 and Bt407ΔflhA [62]. The tatAC operon and the comGA gene in B. cereus ATCC 14579 were deleted by allelic exchange with a spectinomycin resistance cassette (SpR) from pDG1726 [63] as described [64]. Growth conditions and find more sample preparation B. cereus and B. thuringiensis were grown in brain heart infusion (BHI) medium at a temperature of 32°C, since toxin production generally is maximal at this temperature [65]. For analysis of Hbl B overexpressing strains, strains containing plasmid were grown for 3 hours in BHI supplemented with 10 μg ml-1 erythromycin, induced with 20 mM xylose and grown for 2 hours before harvesting. For analysis of mutant strains, overnight cultures were supplemented with 250 μg ml-1 spectinomycin, and culture supernatants and pellets were harvested 1 hour after the onset of stationary phase (t0), as the concentration of toxins appears to be maximal at this time [34]. t0 was defined as the breakpoint

in the slope of the vegetative growth phase curve as determined by measuring the optical density at 600 nm. For analysis of inhibition of SecA by sodium azide, ATCC 14579 was grown to t0, washed twice in pre-warmed BHI, and resuspended in the original volume of fresh pre-warmed BHI. The culture was divided into three cultures: one containing BHI only, one Ketotifen containing 2 mM sodium azide, and one containing 2 mM sodium azide and 200 μM synthetic PapR pentapeptide LPFEY (corresponding to the five carboxy-terminal amino acids in PapR from B. cereus ATCC 14579), incubated as before for a further 20 minutes, and harvested by centrifugation. Culture supernatants were collected by centrifugation and concentrated tenfold for examination of Hbl B overexpressing strains and the tatAC, comGA, and flhA mutants, or 40-fold for azide-treated cultures, by precipitation with 80% ammonium sulphate. Precipitated proteins were dissolved in and selleck chemicals dialysed against TES buffer (20 mM Tris pH 7.5, 0.8% NaCl, 1 mM EDTA).