18 similar to B. subtilis YlaN protein lmo1070 Hypothetical proteins Conserved ttgcgtggcaaataaattatgctatact SigmaA Lmo1255 1.60 trehalose-specific PTS system IIBC component
lmo1255 Energy metabolism Pyruvate dehydrogenase ttgcgctttcaactgatttatagtatagt SigmaA Amino acid biosynthesis Aromatic amino acid family Transport and binding proteins Carbohydrates, organic alcohols, and acids Lmo1439 1.66 superoxide dismutase sodA Cellular processes Detoxification ttgcaagcatttagggagcatggtaggct SigmaA gtttaacttttgagtttcagggaaa SigmaB Lmo1454c 1.85 RNA polymerase sigma factor RpoD rpoD Transcription Transcription factors gttttaaaaccgctaaatgatggtat SigmaB aggacttttgctttttgtggcgaatat SigmaH ttgactttttagcaaaaatacagtatctt AZD6738 solubility dmso SigmaA Lmo2006 1.60 acetolactate synthase catabolic AZD4547 chemical structure alsS Amino acid biosynthesis Aspartate family ttgcaataattcttttgagtagtataat SigmaA Amino acid biosynthesis Pyruvate family Lmo2064 2.01 large conductance mechanosensitive channel protein mscL Cellular processes Adaptations to atypical conditions tttcacatcgcagttagatgttttatact SigmaA Lmo2487 1.65 hypothetical protein lmo2487 Hypothetical proteins Conserved N/A N/A Lmo2614 2.05 50S selleck chemical ribosomal protein L30 rpmD
Protein synthesis Ribosomal proteins: synthesis and modification ttgattactacccctaacccgtgtataat SigmaA Lmo2621 1.63 50S ribosomal protein L24 rplX Protein synthesis Ribosomal proteins: synthesis and modification ttgattactacccctaacccgtgtataat SigmaA Proteins with negative fold change ( < -1.5) and p < 0.05 (indicating Selleckchem Baf-A1 negative regulation by σ H ) Lmo1877 −1.61 formate-tetrahydrofolate ligase fhs Amino acid biosynthesis Aspartate family Protein synthesis tRNA aminoacylation Amino acid biosynthesis Histidine family Purines, pyrimidines, nucleosides, and nucleotides Purine ribonucleotide biosynthesis Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A Lmo2094 −7.35 hypothetical protein lmo2094 Energy metabolism Sugars Lmo2097
−3.17 galactitol-specific PTS system IIB component lmo2097 Energy metabolism Pyruvate dehydrogenase Amino acid biosynthesis Aromatic amino acid family Transport and binding proteins Carbohydrates, organic alcohols, and acids Lmo2098 −2.33 galactitol-specific PTS system IIA component lmo2098 Energy metabolism Pyruvate dehydrogenase Amino acid biosynthesis Aromatic amino acid family Transport and binding proteins Carbohydrates, organic alcohols, and acids aProtein names are based on the L. monocytogenes EGD-e locus. bRole Categories and Sub-Role categories are based on JCVI classification [26]. cReported as positively and directly regulated by σH in Chaturongakul et al., 2011 [7]. dPromoters were identified based on RNA-Seq data (Orsi et al., unpublished) or previously published data. -10 and -35 (σA, σB, σH) and -12 and -24 (σL) regions are underlined.